标签：tween style str rds esc integer hash ++ output
All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.
Example:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" Output: ["AAAAACCCCC", "CCCCCAAAAA"]
Solution: count the frequency of 10 letter words
class Solution { //find all the 10-letter-long sequences that occur more than once in a DNA molecule public List<String> findRepeatedDnaSequences(String s) { //substring -- subset n +n-1+...+1: n-k+1 List<String> res = new ArrayList<String>(); Map<String,Integer> map = new HashMap<String,Integer>(); int n = s.length(); int k =10; if(n < k) return res; for(int i = 0; i<=n-k; i++){//11-10 1 String sub = s.substring(i, i+k); if(map.containsKey(sub)){ map.put(sub, map.get(sub)+1); }else { map.put(sub, 1); } } for(Map.Entry<String, Integer> entry : map.entrySet()){ if(entry.getValue() >1){ res.add(entry.getKey()); } } return res; } }
Solution 2: two HashSet with a non-duplicate feature.
public List<String> findRepeatedDnaSequences(String s) { Set seen = new HashSet(), repeated = new HashSet(); for (int i = 0; i + 9 < s.length(); i++) { String ten = s.substring(i, i + 10); if (!seen.add(ten))//if add then first time, else add it repeated.add(ten); } return new ArrayList(repeated); }
subsequence & substring
subsequence: subset 2^n
substring: continous string : n+n-1+n-2+...+1
*187. Repeated DNA Sequences (hashmap, one for loop)(difference between subsequence & substring)
标签：tween style str rds esc integer hash ++ output
原文地址：https://www.cnblogs.com/stiles/p/leetcode187.html
